rs4377349 chr2:84895283 C>T
- Sequence
gaccttcctaacctggaaaattcc[C/T]caagatctaactgctactttccct
- ASB in cell types
- SGBS (Simpson Golabi Behmel syndrome type 1 adipocytes)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.28 | -1.76 | 1.00 | -0.86 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Uterus, Vagina