rs4378280 chr10:63521058 G>A
- Sequence
gcgaatatctcacttttcacacag[G/A]cactgccaatccctaccctccagt
- ASB in cell types
- SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD2_HUMAN | 0.29 | 1.25 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting insulin, homa-b, homa-ir, ldl cholesterol, spine bone mineral density (bmd), total cholesterol, triglycerides
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis