rs4380795 chr6:119476403 C>A
- Sequence
gaacacaaggcccaggccagctgc[C/A]ccctcggactaccagatgtcaggc
- ASB in cell types
- RPMI8226 (Plasma cell myeloma)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 0.38 | 2.18 | 1.75 | n/a | n/a |
Items per page:
1 – 1 of 1