rs4380889 chr8:33805863 G>A
- Sequence
ctggggaaacttcattaaggcagt[G/A]caaagtaatcagtttcagtcctgg
- ASB in cell types
- glioblastoma cells ID00014 (lymphoblastoid cell, DiGeorge syndrome) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -2.90 | 1.21 | 1.50 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 2.35 | 0.90 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.77 | 0.04 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, fasting insulin, homa-ir, irritible bowel syndrome, ldl cholesterol, microalbuminuria, refractive error, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood