rs4381653 chr17:20961700 A>G
- Sequence
tgtgaatagaactgttacgttctt[A/G]tcgatgtctcttgagacatgtatg
- ASB in cell types
- keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| keratinocytes | 1.64 | 0.08 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi) (within family tests max measurement), homa-b, obesity with early age of onset (age >2), spine bone mineral density (bmd), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid