rs4385369 chr7:1812530 G>A
- Sequence
gggagggaggttgatccctcagag[G/A]ccccggcaggtggcactgtcctct
- ASB in cell types
- T47D (invasive ductal carcinoma) LNCaP (prostate carcinoma) GM19240 (B cells Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN SMC1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.94 | 2.52 | 1.60 | 0.00 | Weak Discordant | |||
| SMC1A_HUMAN | 2.32 | -0.50 | 1.75 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Heart_Atrial_Appendage, Spleen, Whole_Blood