rs4385425 chr7:50267738 A>G
- Sequence
actcagaagatgctcctcagcttg[A/G]agtcaagaagactctggtttgcct
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -0.52 | 1.29 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI granulocyte percentage of myeloid white cells, monocyte count, monocyte percentage of white cells
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, hdl cholesterol change with statins, rheumatoid arthritis, total cholesterol