rs4387040 chr9:105958812 T>G
- Sequence
agtagcatgatcaacaaagctgtg[T/G]cattttagtcgtttaaaacttaat
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.23 | 2.48 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, bipolar disorder, hdl cholesterol, microalbuminuria, tetrology of fallot, urinary albumin-to-creatinine ratio, variant creutzfeldt-jakob disease