rs4388224 chr5:174581641 A>G
- Sequence
ctgtgccgtccttcaaaatcagac[A/G]aagagatgacaaagtaactgggaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.21 | 1.28 | 2.90 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -1.96 | 2.24 | 1.00 |
Items per page:
1 – 2 of 2