rs4388923 chr11:118102843 C>A
- Sequence
tggagggtaagaggcagttaccag[C/A]ctgtttctcccacacacgtgacct
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- EGR1_HUMAN MTG16_HUMAN ARI1B_HUMAN NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | n/a | 2.63 | 2.00 | n/a | No Hit | |||
| MTG16_HUMAN | n/a | 1.22 | 2.00 | n/a | n/a | |||
| ARI1B_HUMAN | n/a | 1.29 | 2.00 | n/a | n/a | |||
| NCOR1_HUMAN | -0.71 | 1.85 | 2.67 | n/a | n/a | |||
| KDM1A_HUMAN | -0.21 | 1.29 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, hdl cholesterol, homa-b, rheumatoid arthritis, waist hip ratio
GTEx eQTL Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Pituitary, Small_Intestine_Terminal_Ileum, Thyroid