rs4391429 chr8:22132335 A>G
- Sequence
cgggcactgggccggacttgggcc[A/G]tgttggcatccattcaccctgccc
- ASB in cell types
- epithelial cell of prostate RWPE2
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -2.13 | 2.53 | 1.00 | |||
| RWPE2 | -1.96 | 2.24 | 1.00 |
Items per page:
1 – 2 of 2