rs4394756 chr10:57657318 C>T
- Sequence
gtgtgtacctgtgggcggctgcaa[C/T]ctttcttgaaggcagagggcacca
- ASB in cell types
- glioblastoma cells WA09 (embryonic stem cells) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | n/a | 1.04 | 2.00 | |||
| WA09 (embryonic stem cells) | 2.26 | -0.22 | 1.50 | |||
| hepatocytes | 1.16 | -0.18 | 1.00 |
Items per page:
1 – 3 of 3