rs4395181 chr18:67133808 C>T
- Sequence
tgttttattggccgtattttgaga[C/T]gatgtgtacataaagtattttgag
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) primary prostate cancer
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | 1.32 | -0.10 | 1.29 | |||
| primary prostate cancer | 2.51 | -4.75 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hip bone mineral density (bmd), ldl cholesterol, spine bone mineral density (bmd)