rs4396552 chr16:80466608 A>C
- Sequence
agcgccatcttgtggctccaggag[A/C]gatgagctacacttcccgcccatt
- ASB in cell types
- A549 (lung carcinoma) HepG2 (hepatoblastoma) MS-1 (Small cell lung carcinoma) ID00015 (lymphoblastoid cell)
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 1.35 | -0.16 | 1.96 | n/a | n/a |
Items per page:
1 – 1 of 1