rs4397361 chr8:33244428 T>G
- Sequence
atgcctttcaatgtcaaaaattgt[T/G]agcattggtatgagactggggtac
- ASB in cell types
- FT282 (normal human fallopian tube tissue) HUVEC-C (HUVEC, umbilical vein endothelial cells) adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| FT282 (normal human fallopian tube tissue) | 1.57 | -0.79 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.22 | -1.04 | 1.75 | |||
| adrenal gland | 1.65 | -1.40 | 1.00 |
Items per page:
1 – 3 of 3