rs4398207 chr19:610729 A>G
- Sequence
cgctgagcaccaggtcctgggggc[A/G]ctgaggctgattggagcgggttta
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPT5H_HUMAN | 0.01 | 1.75 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, total cholesterol change with statins, transmission distortion