rs4402410 chr13:26972230 C>T
- Sequence
tgagcggaagaggttcacttctct[C/T]tgcatatcaggtaaggctccctgg
- ASB in cell types
- GM02630 (Fanconi anemi) GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.48 | 1.53 | 1.61 | n/a | No Hit |
Items per page:
1 – 1 of 1