rs4403422 chr8:143610163 A>G
- Sequence
tgagtgcggttttttcatcatcca[A/G]tctaaagctgcatgttacatatgt
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.82 | 0.25 | 2.01 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -2.15 | 2.42 | 1.25 |
Items per page:
1 – 2 of 2