rs4409785 chr11:95578258 T>C
- Sequence
tctggtgagggtgacactcttcac[T/C]tcaagatggcgtcttgtcactgca
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | n/a | 4.55 | 1.00 | 3.93 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
EMBL-EBI autoimmune thyroid diseases (graves disease or hashimotos thyroiditis), autoimmune traits, eosinophil counts, graves disease, hypothyroidism, medication use (thyroid preparations), multiple sclerosis, multiple sclerosis and ldl levels (pleiotropy), rheumatoid arthritis, vitiligo
GRASP fasting insulin, generalized vitiligo, graves disease, graves disease and hashimotos thyroiditis, hashimotos thyroiditis, late onset alzheimers disease, multiple sclerosis, salmonella-induced pyroptosis, tetrology of fallot, total cholesterol
PheWAS abnormal sputum, acute posthemorrhagic anemia, adrenal hyperfunction, adverse drug events and drug allergies, anemia nos, anemia of chronic disease, angiodysplasia of intestine, aphasia/speech disturbance, benign neoplasm of other endocrine glands, benign neoplasm of unspecified sites, blindness and low vision, calcium/phosphorus disorders, cardiomegaly, cellulitis and abscess of foot/toes, chronic lymphoid leukemia, chronic ulcer of skin, chronic ulcer of unspecified site, conduct disorders, crohns disease, degenerative disease of the spinal cord, dental caries, diseases of hard tissues of teeth, diseases of the oral soft tissues, disorders of lipoid metabolism, disorders of mineral metabolism, disorders of other cranial nerves, disorders of synovium, tendon, and bursa, dysmetabolic syndrome x, enthesopathy, epistaxis or throat hemorrhage, fracture of humerus, fracture of upper limb, functional digestive disorders, graves disease, hemoptysis, hidradenitis, hypercholesterolemia, hyperlipidemia, hyperosmolality and/or hypernatremia, impetigo, inflammatory bowel disease, intestinal infection, intestinal malabsorption, iron deficiency anemia secondary to blood loss, lyme disease, lymphoid leukemia, malaise and fatigue, mammographic microcalcification, mastoiditis, methicillin sensitive staphylococcus aureus, mitral stenosis/insufficiency, mixed hyperlipidemia, musculoskeletal symptoms referable to limbs, myalgia and myositis nos, mycoses, myopia, neoplasm of uncertain behavior, noninfectious gastroenteritis, nontoxic multinodular goiter, open wounds of extremities, oral aphthae, osteoarthrosis, generalized, osteopenia, other anemias, other arthropathies, other hemoglobinopathies, other local infections of skin and subcutaneous tissue, other rheumatic heart disease, other specified peripheral vascular diseases, pain in limb, paralytic strabismus, peripheral arterial disease, peripheral enthesopathies, peripheral vascular disease, personality disorders, photodermatitis & sunburn, pityriasis, poisoning by analgesics, antipyretics, and antirheumatics, polycythemia vera, psoriasis & related disorders, psychogenic and somatoform disorders, pyogenic granuloma, renal dialysis, renal osteodystrophy, sciatica, seborheic dermatitis, shock, somatoform disorder, spirochetal infection, spondylolisthesis, congenital, sprains and strains, stress incontinence, female, symptoms involving digestive system, thyrotoxicosis, ulceration of intestine, ulceration of the lower gi tract