rs4410241 chr2:153287339 G>T
- Sequence
gtgtgttaccatgccactctcagt[G/T]ttgccctctgcaggccgcttgtgt
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line) GM10847 (female B-cells Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.66 | 0.01 | 1.93 | -1.10 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
