rs4412203 chr6:53172201 C>T
- Sequence
caaatatttgtttgagtgagttga[C/T]tctatgtcagtcattaagatcact
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) HUVEC-C (HUVEC, umbilical vein endothelial cells) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -0.27 | 0.55 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.83 | 0.62 | 1.00 | |||
| hepatocytes | 1.27 | -1.09 | 1.00 |
Items per page:
1 – 3 of 3