rs4415968 chr15:65257688 G>A
- Sequence
ctgttgtgaaaattaaccagtata[G/A]taaggtgccttgcaatgttacatg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.79 | -0.87 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, barnes akathisia rating scale, resistance to kuru in aged women despite likely exposure, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Esophagus_Mucosa, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood