rs4417635 chr19:46432156 G>C
- Sequence
aaaagagacgttggttgggggcgg[G/C]ggttccagtttgtcttcaaggatt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.17 | -1.74 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage