rs4417818 chr3:194043059 C>T
- Sequence
caggtgacaggaccctatgcatga[C/T]tgtttccatgtggcatgacagctg
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.23 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting insulin, homa-ir, microalbuminuria, parkinsons disease, refractive error, urinary albumin-to-creatinine ratio, years of education