rs4420201 chr10:34836452 C>A
- Sequence
gtctccaagttctttgcaagcacc[C/A]cgctcttaatcttgatcattcctc
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -2.92 | 2.81 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -0.94 | 1.03 | 1.00 |
Items per page:
1 – 2 of 2