rs4420465 chr14:93139085 A>T
- Sequence
actccgtctcaccaaaaaaaaaaa[A/T]aaaagtatatgtatatatatatat
- ASB in cell types
- thoracic aorta GM18486 (Lymphoblastoid Cell Lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thoracic aorta | n/a | 2.19 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.02 | -0.85 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -1.14 | 1.64 | 1.00 |
Items per page:
1 – 3 of 3