rs4420472 chr15:59247595 G>A
- Sequence
aggcactcaggaagtctatcttgc[G/A]gggtctgatggtgctaacagcaag
- ASB in cell types
- uterus THP-1 (acute monocytic leukemia) GM17942 (lymphoblastoid cell) testis
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| uterus | -2.49 | 2.87 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.63 | 0.93 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | 0.93 | -0.93 | 1.00 | |||
| testis | -2.00 | 2.37 | 1.00 |
Items per page:
1 – 4 of 4