rs4420505 chr15:25793749 T>A
- Sequence
ttgtgggcacataacttcccccaa[T/A]cctccctcagaagcaagggaaaat
- ASB in cell types
- MV-4-11 (Childhood acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MV-4-11 (Childhood acute monocytic leukemia) | 0.42 | 1.31 | 1.06 |
Items per page:
1 – 1 of 1