rs4423078 chr1:205291892 C>T
- Sequence
taccttctgaaaagatttggggag[C/T]ccccaggggttcccccaggggttc
- ASB in cell types
- L1236 (Hodgkin lymphoma)
- ASB for transcription factors
- NFKB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFKB1_HUMAN | -3.64 | 3.69 | 1.00 | 2.41 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Lung, Muscle_Skeletal, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood