rs4428077 chr20:13119678 T>C
- Sequence
tcttctcttcccttcatgttacac[T/C]gcagtgtctaaatttaccactaga
- ASB in cell types
- SUM159PT (Triple negative breast cancer) transverse colon erythroid progenitors upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (Triple negative breast cancer) | -3.61 | 3.29 | 1.00 | |||
| transverse colon | 1.23 | -0.36 | 1.00 | |||
| erythroid progenitors | -4.97 | 2.88 | 2.00 | |||
| upper lobe of left lung | 0.84 | 0.66 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 0.58 | -0.58 | 1.00 |
Items per page:
1 – 5 of 7