rs4429678 chr4:4880718 A>C
- Sequence
cagcgccaccctgtgcctgcccag[A/C]ccaaatattttccccagatggagc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -0.69 | 0.75 | 1.00 | |||
| bipolar neuron | 1.37 | -1.02 | 1.17 |
Items per page:
1 – 2 of 2