rs4429779 chr4:56656480 A>G
- Sequence
agggtgggttcgcccgagtccgcg[A/G]ctagccggcctccggcctccccgg
- ASB in cell types
- neural progenitors GM18526 (B – cells Lymphoblastoid Cell Lines) Peyer's patch GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | 2.02 | -1.23 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 2.27 | n/a | 1.00 | |||
| Peyer's patch | 1.85 | -1.21 | 1.17 | |||
| GM17942 (lymphoblastoid cell) | -2.02 | 2.17 | 1.00 | |||
| IMR-5 (Neuroblastoma) | 1.94 | -3.78 | 1.50 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Kidney_Cortex, Muscle_Skeletal, Nerve_Tibial, Ovary, Prostate, Stomach, Thyroid, Uterus, Whole_Blood