rs4430786 chr17:15157290 C>A
- Sequence
aatgacacatccgttcctctcatg[C/A]tttgacttcctctaacttcctctt
- ASB in cell types
- macrophages form periferal blood TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.18 | 0.44 | 1.45 | n/a | No Hit |
Items per page:
1 – 1 of 1