rs4435430 chr2:35343238 C>A
- Sequence
gaggtttttcccccagggtctccc[C/A]cttttgcccccttaaactgctttt
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | 1.57 | -1.03 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 1.52 | -1.33 | 1.00 |
Items per page:
1 – 2 of 2