rs4437170 chr3:163043241 G>A
- Sequence
cttcccacatgaggaagaggtccc[G/A]tttccaatgccccacttgtttgca
- ASB in cell types
- NB69 (neuroblastoma) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NB69 (neuroblastoma) | -4.17 | 2.85 | 1.33 | |||
| bipolar neuron | -0.69 | 2.00 | 1.25 |
Items per page:
1 – 2 of 2