rs4437470 chr6:53718984 A>T
- Sequence
aactccacatcaaaagaaaaaata[A/T]aagagcttttaccattccatgatt
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -0.14 | 1.64 | 1.00 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.70 | 0.55 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid