rs4437763 chr9:91151297 C>T
- Sequence
aatagtcccccagggcaggaactt[C/T]tcgtctctctgaacacagaatgtc
- ASB in cell types
- bone-marrow-derived mesenchymal stromal cells, adipocyte differentiation 4 hrs CD4+ T-cells bone-marrow-derived mesenchymal stromal cells, adipocyte differentiation day 1 GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- MBD4_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MBD4_HUMAN | 2.88 | -3.66 | 1.50 | n/a | n/a | |||
| EP300_HUMAN | 1.34 | 0.04 | 1.25 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Thyroid, Whole_Blood