rs4438317 chr16:79981444 C>G
- Sequence
ctgaacacaaaaggcaaacacaat[C/G]tatggatttctgaataatacaaag
- ASB in cell types
- CD34+ iPSC-differentiated NSC
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ iPSC-differentiated NSC | -1.88 | 2.28 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), height, ldl cholesterol, lp-pla2 activity, triglycerides