rs4438745 chr4:8278533 C>T
- Sequence
tctgcttcccagccgtggggccca[C/T]ggttttcctgtggaaagaggcagt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -3.94 | 1.57 | 3.00 | |||
| BEAS-2B (bronchial epithelium) | 0.87 | 0.06 | 1.50 |
Items per page:
1 – 2 of 2