rs4440995 chr11:31816580 G>A
- Sequence
tccacttcccactgcgaagcaggc[G/A]acctgctcgccgcccagctccagg
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 0.31 | 1.04 | 1.38 | n/a | n/a |
Items per page:
1 – 1 of 1