rs4441358 chr18:43077678 G>A
- Sequence
tgtaacatgagcaatgtagcaagc[G/A]ctttttataactgacagcccatca
- ASB in cell types
- neural cell
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 2.33 | -1.93 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hypertension (early onset hypertension), irritible bowel syndrome, ldl cholesterol, parkinsons disease, resistance to kuru in aged women despite likely exposure