rs4442821 chr16:87816457 G>C
- Sequence
gttggggtcatacaggacttgccc[G/C]agaacaggaaacccaagtcaaact
- ASB in cell types
- RCH-ACV (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1))
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | -2.97 | 2.04 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1