rs4443498 chr6:38877896 C>G
- Sequence
taggcactactggactgaaatcac[C/G]gagggaagtgaaacaaggtgattg
- ASB in cell types
- macrophages form periferal blood MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 1.49 | -0.06 | 2.00 | |||
| MDM(monocyte derived macrophages) | -0.98 | 3.07 | 2.20 |
Items per page:
1 – 2 of 2