rs4444720 chr3:176327313 C>G
- Sequence
acttcaggccatctgggcgtatac[C/G]tgcaagtcacaggagatgcgatgg
- ASB in cell types
- WA09 (embryonic stem cells)
- ASB for transcription factors
- NANOG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NANOG_HUMAN | 2.26 | -0.84 | 2.00 | -0.91 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
