rs4451666 chr10:34961389 G>A
- Sequence
caatctcggctcactgcagccccc[G/A]tctctcgggttcaagcgattctcc
- ASB in cell types
- epithelial cell of prostate 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -1.85 | 2.25 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.76 | -0.17 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Thyroid