rs4452416 chr4:23862250 T>G
- Sequence
acttggacaaagtcaggtcaagtc[T/G]ctgctagatgtttaggtagaggtg
- ASB in cell types
- BJ (fibroblasts)
- ASB for transcription factors
- P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P63_HUMAN | 2.05 | -1.75 | 1.00 | -0.99 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP birth weight, hypertriglyceridemia, maternal transmission distortion, sporadic creutzfeldt-jakob disease, tetrology of fallot, total cholesterol