rs4452682 chr6:3415068 G>A
- Sequence
aggtaataatagcatctcctattc[G/A]gggtgttgtaaggagatgttaatg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.08 | 0.86 | 2.93 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bronchodilator response in asthma, hdl cholesterol change with statins, neuroblastoma (brain cancer), prop taste detection threshold, urinary albumin-to-creatinine ratio