rs4453941 chr4:39527356 C>T
- Sequence
acagcaccttcctacgggccgcgc[C/T]gccgcagcttctccacccgcgccc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma) LNCaP C4-2B (prostate carcinoma) SUM159PT (Triple negative breast cancer)
- ASB for transcription factors
- TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | -0.09 | 3.67 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Whole_Blood