rs4455065 chr18:5074050 A>G
- Sequence
gagcctacactttctacccactag[A/G]aaacttttctgaacacagagaagt
- ASB in cell types
- LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LUHMES (lund human mesencephalic cells) | -1.09 | 1.84 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, barnes akathisia rating scale, systolic blood pressure (sbp), triglycerides