rs4455396 chr4:149031524 A>C
- Sequence
gttgagaatttaccaactttggaa[A/C]ctgcttggtcctcagctttcttta
- ASB in cell types
- H929 (plasma cell myeloma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -3.16 | 3.32 | 1.00 | |||
| foreskin keratinocyte | 1.03 | n/a | 3.00 |
Items per page:
1 – 2 of 2